shrna expression vector pentr u6 (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
86
Structured Review
Thermo Fisher
shrna expression vector pentr u6
Shrna Expression Vector Pentr U6, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+expression+vector+pentr+u6/pm28680813-49-32-36
Average 86 stars, based on 1 article reviews
Shrna Expression Vector Pentr U6, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+expression+vector+pentr+u6/pm28680813-49-32-36
Average 86 stars, based on 1 article reviews
shrna expression vector pentr u6 - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
In Vivo:Article Title: Silencing of FABP1 ameliorates hepatic steatosis, inflammation, and oxidative stress in mice with nonalcoholic fatty liver disease. Article Snippet: .. Adenovirus preparation and in vivo animal injection The DNA sequences corresponding to the short hairpin RNA (shRNA) sequences of FABP1: 50-CACCGAACT CAATGGAGACACAATCCGAAGATTGTGTCTCCAT TGAGTTC-30 and 50-AAAAGAACTCAATGGAGACA CAATCTTCGGATTGTGTCTCCATTGAGTTC-30 were annealed and ligated into the Injection:Article Title: Silencing of FABP1 ameliorates hepatic steatosis, inflammation, and oxidative stress in mice with nonalcoholic fatty liver disease. Article Snippet: .. Adenovirus preparation and in vivo animal injection The DNA sequences corresponding to the short hairpin RNA (shRNA) sequences of FABP1: 50-CACCGAACT CAATGGAGACACAATCCGAAGATTGTGTCTCCAT TGAGTTC-30 and 50-AAAAGAACTCAATGGAGACA CAATCTTCGGATTGTGTCTCCATTGAGTTC-30 were annealed and ligated into the shRNA:Article Title: Silencing of FABP1 ameliorates hepatic steatosis, inflammation, and oxidative stress in mice with nonalcoholic fatty liver disease. Article Snippet: .. Adenovirus preparation and in vivo animal injection The DNA sequences corresponding to the short hairpin RNA (shRNA) sequences of FABP1: 50-CACCGAACT CAATGGAGACACAATCCGAAGATTGTGTCTCCAT TGAGTTC-30 and 50-AAAAGAACTCAATGGAGACA CAATCTTCGGATTGTGTCTCCATTGAGTTC-30 were annealed and ligated into the Expressing:Article Title: Silencing of FABP1 ameliorates hepatic steatosis, inflammation, and oxidative stress in mice with nonalcoholic fatty liver disease. Article Snippet: .. Adenovirus preparation and in vivo animal injection The DNA sequences corresponding to the short hairpin RNA (shRNA) sequences of FABP1: 50-CACCGAACT CAATGGAGACACAATCCGAAGATTGTGTCTCCAT TGAGTTC-30 and 50-AAAAGAACTCAATGGAGACA CAATCTTCGGATTGTGTCTCCATTGAGTTC-30 were annealed and ligated into the Plasmid Preparation:Article Title: Silencing of FABP1 ameliorates hepatic steatosis, inflammation, and oxidative stress in mice with nonalcoholic fatty liver disease. Article Snippet: .. Adenovirus preparation and in vivo animal injection The DNA sequences corresponding to the short hairpin RNA (shRNA) sequences of FABP1: 50-CACCGAACT CAATGGAGACACAATCCGAAGATTGTGTCTCCAT TGAGTTC-30 and 50-AAAAGAACTCAATGGAGACA CAATCTTCGGATTGTGTCTCCATTGAGTTC-30 were annealed and ligated into the |